Journal Search Engine
Download PDF Export Citation PMC Previewer
ISSN : 1225-5009(Print)
ISSN : 2287-772X(Online)
Flower Research Journal Vol.33 No.4 pp.188-194
DOI : https://doi.org/10.11623/frj.2025.33.4.03

Single Nucleotide Polymorphisms in the Mitochondrial nad7 Intron of Six Native Phedimus and Sedum Species

Mi Sang Lim, Sun Hee Choi*
Department of Horticultural Biotechnology and Landscape Architecture, Seoul Women’s University, Seoul 01797, Korea


Correspondence to Sun Hee Choi Tel: +82-2-970-5612 E-mail: paxs@swu.ac.kr ORCID: https://orcid.org/0000-0002-4485-1574
15/09/2025 06/11/2025

Abstract


The Crassulaceae family displays extensive morphological diversity and complex evolutionary trajectories across its constituent genera. These attributes significantly challenge the reconstruction of intrafamilial phylogenetic relationships. While chloroplast and nuclear DNA markers are widely used for phylogenetic analyses, mitochondrial DNA (mtDNA) remains underutilized, despite its demonstrable potential as a taxonomic marker. Sequence variation in the mitochondrial nad7 intron was analyzed across six species representing two genera (Phedimus and Sedum) native to Korea. The objective was to assess genetic diversity and determine whether the nad7 intron could effectively augment existing chloroplast and nuclear DNA markers as a taxonomic tool. Target amplicon length spanned 974 to 998 base pairs (bp). Multiple sequence alignment of the six Crassulaceae species from Phedimus and Sedum identified single nucleotide polymorphisms (SNPs), insertions/deletions (INDELs), and dinucleotide polymorphisms, interspersed with conserved nad7 intron regions. Interestingly, an INDEL at positions 189–192 exhibited a diagnostic genus-level pattern, facilitating the unambiguous separation of Phedimus and Sedum. This outcome is consistent with established morphological and chloroplast DNA–based classifications. Collectively, these findings validate the mitochondrial nad7 intron as a promising supplementary molecular marker for taxonomic classification and genetic resource conservation within Crassulaceae.




초록


    Introduction

    Although Crassulaceae species are distributed worldwide, they primarily occur in semiarid and mountainous regions of temperate and subtropical climates (Eggli 2003). In addition to strong physiological adaptability, including water conservation in arid environments through CAM photosynthesis and succulent leaves, the family displays various morphological diversity, such as growth habits, leaves, stems, flowers, fruit (Borland et al. 2009;Zhang et al. 2024). In South Korea, 53 species of native Crassulaceae plants were found, including 12 species of Sedum and 10 species of Phedimus (http:// www.nature.go.kr/kpni/SubIndex.do).

    The Crassulaceae was traditionally divided into six subfamilies based on morphology (Berger 1930). Classification of Berger provided a fundamental framework for the intra- and interspecific taxonomy of the family. However, it was considered artificial because similar traits had evolved independently in different lineages within the Crassulaceae as a result of convergent evolution. Consequently, ’t Hart (1995) emphasized the need for molecular-based analysis. Subsequent studies further criticized Berger’s original taxonomy as artificial and insufficiently reflective of evolutionary relationships within the Crassulacae (Gontcharova and Gontcharov 2006;Mort et al. 2001). Taxonomic classification is challenging due to the morphological diversity within the Crassulaceae and the occurrence of parallel and convergent evolution among its genera (Messerschmid et al. 2020;Mort et al. 2001).

    Molecular markers have since been actively applied to resolve complex phylogenetic relationships in the family (Ding et al. 2022b;Kim et al. 2023;Rodewald et al. 2025). Nuclear ribosomal DNA (rDNA), including internal transcribed spacer, and chloroplast DNA (cpDNA) markers, such as matK, rbcL, ndhF, and trnL-F, continue to be used for genus- and species-level classification (Ding et al. 2022a;Messerschmid et al. 2020;Mort et al. 2001;Nikulin et al. 2016). Despite these advances, polyphyly, convergent evolution, natural hybridization via open pollination, and frequent gene flow within Crassulaceae complicate molecular phylogenetic studies, especially in phylogenetic trees based on maternally inherited chloroplast genomes. Consequently, there are intrinsic limitations to relying solely on cpDNA for phylogenetic research of Crassulaceae.

    Furthermore, mitochondrial DNA (mtDNA) can serve as a molecular marker. Due to its diverse structural variations, such as single nucleotide polymorphisms (SNPs) and insertions/deletions (INDELs), as well as inheritance independent of cpDNA and nuclear DNA, mtDNA provides a complementary resource to these two DNA markers (Mower et al. 2007; Sloan et al. 2010). However, mtDNA studies in Crassulaceae phylogenetics remain scarce. Ding et al. (2022b) applied mitochondrial genome data for the first time in phylogenetic analysis of Crassulaceae species, demonstrating its potential as a molecular marker.

    Despite their strengths, the use of mtDNA markers in plant phylogenetics remains limited. Applying mtDNAderived SNP markers in groups such as Crassulaceae can yield new insights into plant evolutionary pathways. Combined with cpDNA and rDNA markers, mtDNA markers are valuable tools for species identification and genetic resource conservation.

    Therefore, this study investigates genetic variation in six native Korean Phedimus and Sedum species and explores whether mtDNA, specifically the nad7 intron can complement cpDNA and nuclear markers as a taxonomic indicator. The nad7 intron was chosen because it represents a relatively conserved mitochondrial region and still exhibits a moderate level of sequence variation suitable for interspecific comparison. It maintains a stable exon-intron region across angiosperms, which facilitates consistent amplification and the detection of informative SNP and INDEL polymorphisms (Grosser et al. 2023; Mower et al. 2010; Sloan et al. 2010).

    Materials and Methods

    Plant materials and genomic DNA extraction

    Six native Crassulaceae species from two genera were analyzed: Phedimus kamtschaticus, P. middendorffianus, P. takesimensis, Sedum bulbiferum, S. makinoi, S. sarmentosum. P. kamtschaticus and P. middendorffianus were originally obtained from the Useful Plant Resources Center of the Korea National Arboretum in Gyeonggi Province, Korea, and had been maintained in the laboratory since 2019. P. takesimensis, S. bulbiferum, and S. sarmentosum were collected on the campus of Seoul Women’s University. S. makinoi was purchased from a commercial plant market.

    Total genomic DNA was extracted from 100 mg of fresh leaf tissue using the DNeasy Plant Mini Kit (Qiagen, USA), according to the manufacturer’s protocol. DNA concentration and purity were measured spectrophotometrically at 260 nm using a NanoDrop 2000 spectrophotometer (Thermo Scientific, USA), and integrity was confirmed via agarose gel electrophoresis stained with Midori Green (Nippon Genetics Europe, Germany).

    Amplification and sequencing of mtDNA

    To detect sequence variation, the nad7 intron, including 51 nucleotides of flanking exons (Fig. 1), was amplified using primers (F, AACGGAGAAGTGGTGGAACG; R, TTTCTCAGTCCCTCTAGTCG) designed by Grosser (2023). PCR amplification reactions contained the following (total volume: 20 μL): 100–200 ng of genomic DNA; 20 pmole/μL of each primer; 10 mM Tris-HCl (pH 8.3); 50 mM KCl; 1.5 mM MgCl2; 0.25 mM each of dATP, dGTP, dCTP, and dTTP; one unit of Taq DNA polymerase (Takara, Japan); and sterilized water. The amplification conditions were as follows: initial denaturation step at 94°C for 3 min; 30 cycles of 94°C for 1 min, 58°C for 30 s, and 72°C for 1 min 30 s; and a final extension at 72°C for 5 min. The PCR products were electrophoresed on 1% agarose gel in 0.5× TAE buffer at 135 V for 18 min and visualized using Midori Green dye (Nippon Genetics Europe, Germany). Amplified fragments were ligated into the pGEM-T Easy vector (Promega, USA) and transformed into Escherichia coli strain DH5α (Real Biotech Corporation, Taiwan). Recombinant plasmids were isolated using a small-scale alkaline lysis (Sambrook et al. 1989). Sequencing was performed by Macrogen Inc. (South Korea) using the universal primer (T7).

    Multiple alignment and sequence analysis

    ClustalW in MEGA 12 (PA, USA) was used to perform sequence alignments to identify conserved and variable regions in the nad7 intron. The alignment parameters were as follows: pairwise and multiple alignment gap opening penalties, 15.00; gap extension penalties, 6.66, DNA weight matrix (IUB); transition weight, 0.50; negative matrix off; and delay divergent cutoff, 30%. In addition, mtDNA sequences of five Crassulaceae plants and three outgroup sequences obtained from the National Center for Biotechnology Information (NCBI) were included to broaden the scope of the analysis and improve the accuracy of the alignment.

    Based on multiple sequence alignment, SNPs and INDELs were identified among the six Crassulaceae species. These were manually verified, categorized via aligned sequence comparisons, and evaluated for their potential as molecular markers in genus-level discrimination within Crassulaceae.

    Using the obtained mitochondrial sequences, phylogenetic analysis was performed to explore evolutionary relationships and genetic distances among Crassulaceae species, with analysis conditions optimized for mtDNA characteristics. MEGA 12 was employed with the maximum likelihood (ML) method under the general time reversible model with gamma distributed rates and invariant sites (G+I). Nodal support was tested with 1,000 bootstrap replicates. Partial deletion with a 95% site coverage cutoff was applied for gap treatment. The ML heuristic search used the nearest neighbor interchange method, and the initial tree was generated automatically (default NJ/MP).

    Results and Discussion

    To examine mitochondrial sequence variation in Crassulaceae, the nad7 intron was amplified from six species in two genera (Phedimus and Sedum). Each sample produced distinct single bands, and sequencing verified successful amplification of the target areas. Amplicon lengths varied from 974 to 998 base pairs (bp) (Table 1). P. kamtschaticus showed the longest fragment (998 bp), whereas P. takesimensis and P. middendorffianus had 989 and 990 bp fragments, respectively. Among Sedum, S. makinoi exhibited the smallest fragment length (974 bp), whereas S. bulbiferum and S. sarmentosum displayed 978 and 977 bp fragments, respectively.

    To further assess sequence variation in Crassulaceae, multiple sequence alignment was performed using MEGA 12 with mitochondrial nad7 intron sequences from six Crassulaceae species along with reference sequences from NCBI (Table 2). The alignment revealed conserved regions and several types of variation, including SNPs, INDELs, and a dinucleotide polymorphism (DNP). An INDEL at positions 189–192 was particularly diagnostic (Table 2). Phedimus retained most of the sequence (“CCCC” or “CCC-”), whereas Sedum species lost part of it (“C---”). Each genus showed a distinct pattern in this region, indicating clear genus-level structural differences.

    SNPs were detected at various positions such as 238, 303, 424, 465, 555, 575, 611, 649, 720, 760, 859, and 861 within nad7 intron sequences. Furthermore, a DNP was detected at positions 871 and 872, enhancing the structural diversity among species. INDELs also occurred at positions 592–599 and 738–746. These variations demonstrated differing base composition between the two genera. These findings indicate that polymorphic sites within the nad7 intron may function as effective molecular markers for differentiating closely related taxa within Crassulaceae.

    This study examined sequence variation in the mitochondrial nad7 intron and evaluated its potential usefulness as supplementary information for taxonomic inference in Crassulaceae. Structural differences, such as INDELs and SNPs, were discovered between genera based on the analysis of nucleotide sequences. Notably, the INDEL located at positions 189–192 showed a genus-specific pattern, enabling the clear differentiation of Phedimus and Sedum. Therefore, the mitochondrial nad7 intron possesses taxonomically informative variation, consistent with findings reported in earlier studies (Fridjonsson et al. 2011;Grosser et al. 2023).

    Phylogenetic analysis was conducted to determine genetic relationships between the Crassulaceae species obtained herein and those documented earlier (Fig. 2). Genetic distances ranged from 0.002 to 0.036 (distance matrix data not shown). The tree organized all six Crassulaceae species into two distinct monophyletic clades: Phedimus and Sedum. This topology aligned with previous morphological classifications and cpDNA-focused analyses (Kim et al. 2023;Mort et al. 2001;Nikulin et al. 2016).

    Conventionally, cpDNA markers, such as matK, rbcL, and trnL-F, have been the primary tools for Crassulaceae classification (Ding et al. 2022a;Kim et al. 2023;Mort et al. 2001). However, cpDNA is maternally inherited, provides low resolution of interspecific variation, and is limited in groups with regular hybridization and gene flow (Messerschmid et al. 2020;Nikulin et al. 2016). In contrast, mtDNA functions as a complementary marker because of its considerable structural diversity in noncoding regions, low recombination frequency, and inheritance independent of cpDNA (Mower et al. 2012;Sloan et al. 2010).

    Notably, mtDNA is still not widely utilized in plant systematics; nevertheless, its potential has been highlighted in taxa such as Cactaceae and Caryophyllales (Cruz Plancarte and Solórzano 2023;Taylor et al. 2023) and studies using whole mitochondrial genomes in Crassulaceae have proven its effectiveness (Ding et al. 2022b).

    In conclusion, the mitochondrial nad7 intron may represent a valuable auxiliary marker for molecular classification and conservation of genetic resources in Crassulaceae. Combined analyses with cpDNA and nuclear DNA markers will enable more accurate systematic studies in groups complicated by morphological convergence, hybridization, and gene flow. Future research should broaden sampling across species and geographic regions and include comparative analyses of multiple genes.

    Acknowledgements

    This work was supported by a sabbatical year research grant from Seoul Women’s University (2024).

    Figure

    FRJ-33-4-188_F1.jpg

    Edited multiple sequence alignment of nad7 intron sequences from six Crassulaceae species (P. kamtschaticus, P. takesimensis, P. middendorffianus, S. sarmentosum, S. makinoi, and S. bulbiferum); only the region containing the representative INDEL (positions 189–192) is displayed. The INDEL is highlighted with a black box, and its position is indicated in yellow above the alignment.

    FRJ-33-4-188_F2.jpg

    Phylogenetic tree based on mitochondrial nad7 intron sequences from Crassulaceae species.

    Table

    Plant materials, amplicon length, and nad7 intron sequence accession numbers.

    Sequence variation in the mitochondrial nad7 introns of Crassulaceae species.

    Dashes (-) indicate nucleotide deletions

    Reference

    1. Berger A ( 1930) Crassulaceae. In: Engler A, Prantl K (eds) Die natürlichen pflanzenfamilien. 2nd ed. 18a:352–483
    2. Borland AM, Griffiths H, Hartwell J, Smith JAC ( 2009) Exploiting the potential of plants with crassulacean acid metabolism for bioenergy production on marginal lands. J Exp Bot 60:2879-2896
    3. Cruz Plancarte D, Solórzano S ( 2023) Structural and gene composition variation of the complete mitochondrial genome of Mammillaria huitzilopochtli (Cactaceae, Caryophyllales), revealed by de novo assembly. BMC Genomics 24:509
    4. Ding H, Bi D, Zhang S, Han S, Ye Y, Yi R, Yang J, Liu B, Wu L, Zhuo R, Kan X ( 2022) The mitogenome of Sedum Plumbizincicola (Crassulaceae): Insights into RNA editing, lateral gene transfer, and phylogenetic implications. Biology 11:1661
    5. Ding H, Han, S, Ye Y, Bi D, Zhang S, Yi R, Gao J, Yang J, Wu L, Kan X ( 2022) Ten plastomes of Crassula (Crassulaceae) and phylogenetic implications. Biology 11:1779
    6. Eggli U (ed) ( 2003) Illustrated handbook of succulent plants: Crassulaceae. Springer-Verlag, Berlin, Heidelberg
    7. Fridjonsson O, Olafsson K, Tompsett S, Bjornsdottir S, Consuegra S, Knox D, Leaniz CGD, Magnusdottir S, Olafsdottir G, Verspoor E, Hjorleifsdottir S ( 2011) Detection and mapping of mtDNA SNPs in Atlantic salmon using high throughput DNA sequencing. BMC Genomics 12:1-10
    8. Gontcharova SB, Artyukova EV, Gontcharov AA ( 2006) Phylogenetic relationships among members of the subfamily Sedoideae (Crassulaceae) inferred from the ITS region sequences of nuclear rDNA. Russ J Genet 42:654-661
    9. Grosser MR, Sites SK, Murata MM, Lopez Y, Chamusco KC, Love Harriage K, Grosser JW, Graham JH, Gmitter Jr FG, Chase CD ( 2023) Plant mitochondrial introns as genetic markers-conservation and variation. Front Plant Sci 14:1116851
    10. Kim Y, Kim SH, Yang J, Cho MS, Koldaeva M, Ito T, Kim SC ( 2023) Plastome-based backbone phylogeny of East Asian Phedimus (Subgenus Aizoon: Crassulaceae), with special emphasis on Korean endemics. Front Plant Sci 14:1089165
    11. Messerschmid TF, Klein JT, Kadereit G, Kadereit JW ( 2020) Linnaeus’s folly–phylogeny, evolution and classification of Sedum (Crassulaceae) and Crassulaceae subfamily Sempervivoideae. Taxon 69:892-926
    12. Mort ME, Soltis DE, Soltis PS, Francisco‐Ortega J, Santos‐Guerra A ( 2001) Phylogenetic relationships and evolution of Crassulaceae inferred from matK sequence data. Am J Bot 88:76-91
    13. Mower JP, Sloan DB, Alverson AJ ( 2012) Plant mitochondrial genome diversity: The genomics revolution. In: Wendel JF, Greilhuber J, Dolezel J, Leitch IJ (eds) Plant genome diversity, vol 1: Plant genomes, their residents, and their evolutionary dynamics. Springer, Vienna, pp 123-144
    14. Nikulin VY, Gontcharova SB, Stephenson R, Gontcharov AA ( 2016) Phylogenetic relationships between Sedum L. and related genera (Crassulaceae) based on ITS rDNA sequence comparisons. Flora 224:218–229
    15. Rodewald SE, Klein DP, Shtein R, Smith GF, Joyce EM, Morales-Briones DF, Bernhard S, Letsara R, Mertes H, Hühn P, Kadereit G ( 2025) A new phylogenetic framework for the genus Kalanchoe (Crassulaceae) and implications for infrageneric classification. Ann Bot. 135:1311–1328
    16. Sambrook J, Fritsch EF, Maniatis T ( 1989) Molecular cloning: A laboratory manual. 2nd ed, Cold Spring Harbor Laboratory Press, Cold Spring Harbor
    17. Sloan DB, MacQueen AH, Alverson AJ, Palmer JD, Taylor DR ( 2010) Extensive loss of RNA editing sites in rapidly evolving Silene mitochondrial genomes: Selection vs. retroprocessing as the driving force. Genetics 185: 1369-1380
    18. ’t Hart H ( 1995) Infrafamilial and generic classification of the Crassulaceae. In: ’t Hart H, Eggli U (eds) Evolution and systematics of the Crassulaceae. Backhuys, Leiden, pp159–172
    19. Taylor NP, Zappi DC, Romeiro‐Brito M, Telhe MC, Franco FF, Moraes EM ( 2023) A phylogeny of Cereus (Cactaceae) and the placement and description of two new species. Taxon, 72:1321-1333
    20. Zhang J, Song F, Xu X, Xia T, Zhang X, Dong L, Yin D ( 2024) Comprehensive evaluation of morphological and physiological responses of seventeen Crassulaceae species to waterlogging and drainage under temperate monsoon climate. BMC Plant Biol 24:6
    
    1. SEARCH
    2. Journal Abbreviation : 'Flower Res. J.'
      Frequency : Quarterly
      Doi Prefix : 10.11623/frj.
      ISSN : 1225-5009 (Print) / 2287-772X (Online)
      Year of Launching : 1991
      Publisher : The Korean Society for Floricultural Science
      Indexed/Tracked/Covered By :

    3. Online Submission

      submission.ijfs.org

    4. Template DOWNLOAD

      Original Research
      Articles
      국문 영문
      Review Articles 리뷰
      ★NEWTechnical Reports단보
      New Cultivar
      Introduction
      품종
    5. 논문유사도검사

    6. KSFS

      Korean Society for
      Floricultural Science

    7. Contact Us
      Flower Research Journal

      - Tel: +82-54-820-5472
      - E-mail: kafid@hanmail.net