ISSN : 2287-772X(Online)
DOI : https://doi.org/10.11623/frj.2012.20.4.218
Elimination of Chrysanthemum stunt viroid (CSVd) from an Viroidinfected Chrysanthemum through Shoot Tip Culture
Abstract
- Introduction
- Materials and Methods
- Plant materials
- In vitro thermotherapy
- Growth characteristics of CSVd-free and infected plants
- CSVd detection by RT-PCR
- Results and Discussion
- Effect of meristem size on CSVd elimination
- Effect of in vitro thermotherapy combined with shoot tip culture.
- Growth characteristics of CSVd-free chrysanthemum plants
- Acknowledgement
Introduction
Chrysanthemum is one of important floricultural crops worldwide as well as in Korea. It occupies around 30% of total cut-flower cultivation area of 1,975 ha in Korea (MIFAFF, 2011). Nowadays, chrysanthemum stunt viroid (CSVd) and tomato spotted wilt virus (TSWV) are serious problems in chrysanthemum cultivation (Chung et al., 2005). Because these diseases are very difficult to eliminate from chrysanthemum plants by conventional apical meristem culture methods, much effort has been made to generate chrysanthemum plants completely free of CSVd.
Viroids are the sub-viral RNA pathogens, which induce a serious economic problem in crop production. Viroids are classified into two families, Avsunviroidae and Pospiviroidae (Flores et al., 1998). Chrysanthemum stunt viroid (CSVd), a species from Pospiviroidae family, is known as one of the major viroids (Randles, 2003) and one of the hardest-to-eradicate pathogens (Hosokawa et al., 2004) in the chrysanthemum plants. Symptoms of chrysanthemum caused by CSVd showed stem stunting, small number and size of flowers and early flowering (Hollings and Stone, 1970). The stem stunting symptom was firstly reported by Dimock (1947) and was identified as a viroid for the first time by Diener and Lawson (1973). Knapp et al. (1995) observed that apple stem grooving virus exists even in the youngest leaf primordium of Malus and Prunus. In addition, potato spindle tuber viroid (PSTVd) was reported not to exist in the apical meristem dome of tobacco (Zhu et al., 2001). These data suggest the necessity of regenerating shoots from leaf primordia-free shoot apical meristems (LPfree SAMs) to produce plants free of certain kinds of viruses or viroids. Viroid-free chrysanthemum plants have been obtained by meristem-tip culture after heat treatment (Hollings and Stone, 1970). Hosokawa et al. (2004) also have succeed in elimination of chrysanthemum stunt viroid from an infected chrysanthemum cultivar by shoot regeneration from a leaf primordium-free shoot apical meristem dome attached to a root tip.
Vegetative propagation practices largely affected worldwide dissemination of chrysanthemum viruses and viroids (Hosokawa et al., 2004; Siano et al., 2007). Similarly to viruses, the most effective strategy for preventing or reducing the spread of viroids relies on the use of pathogen-free propagation material. The aim of this study is to test how efficiently could CSVd be eliminated from infected chrysanthemum plants by shoot tips culture combined with therapy.
Materials and Methods
Plant materials
Spray type chrysanthemum (Dendranthema grandiflorum) ‘Ency’ showed CSVd symptoms was collected from commercial greenhouse in Chilgok, Kyeongbuk province. They were maintained in greenhouse and propagated by cutting. Shoots (3-5 cm in length) trimmed from each infected plant were sterilized with a 10% (v/v) solution of commercial hypochlorite and 0.05% (v/v) Tween 20 for 10-15min and then washed sterile distilled water three times. After then, shoot tips with 1 to 4 leaf primordial and 0.5 cm of nodal sections were cultured in 25 × 150mm glass tubes containing 15mL of culture medium based on Murashige and Skoog (MS) basal salts (Murashige and Skoog, 1962) supplemented with 0.5mg·L-1 Kinetin, 30mg·L-1 sucrose and 8 g·L-1 plant agar (Sigma-Aldrich, St. Louis, MO). Plantlets regenerated from nodal cultures were maintained at 22 ± 2˚C under 16 hr of cool white fluorescent light (40 μmolm-2 s-1) per day, and sub-cultured every 2month interval. The one-month-old plantlets were tested again to be positive by the PCR assay before thermotherapy. The plantlets were then used to excise shoot tips after the thermotherapy. Plantlets derived from shoot tips were cultured under the same culture conditions for 2 months and then analyzed by reverse transcriptase polymerase chain reaction (RT-PCR). An uninfected plantlet was maintained in the same growth condition and used as a negative control.
In vitro thermotherapy
For heat therapy, one-month-old plantlets were incubated at 37˚C under 16 hr of cool white fluorescent light (400 μmol·m-2·s-1) and 80% humidity for 2, 4, 6, and 8 weeks in a growth chamber. Meristems sized 0.2-0.4mm with one or two leaf primordia was excised from heat treated and untreated explants, separately. They were cultured on MS basal medium supplemented with 0.5mg·L-1 kinetin, 30mg·L-1 sucrose and 8 g·L-1 plant agar at 22 ± 2˚C with low light (20 μmol·m-2·s-1) for one week and then transferred to the standard growth condition.
Growth characteristics of CSVd-free and infected plants
Regenerated CSVd-free plantlets were transplanted to 8 cm-diameter pots filled with potting mix (Metro Mix 360, Scotts) and were grown in a greenhouse. The night temperature of the greenhouse was maintained at 18˚C. For comparison of vegetative growth haracteristics between CSVd-free plants and CSVd-infected plants, all plants were grown under night interruption lighting conditions for vegetative growth.
CSVd detection by RT-PCR
Shoots from regenerated plantlets and leaves from greenhouse plants were used. Total RNA was extracted from young leaves (0.1g) of various seedlings using either Trizol reagent (Invitrogen, USA) or an RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions.
Reverse transcriptase (RT) reactions were conducted on a SuperCycler Gradient Cycler SC200 (Kyratec., Australia) by using 1 μg of RNA and High Capacity cDNA Reverse Transcription kit (Applied Biosystems) according to the manufacturer’s instructions. PCR reaction was performed using 20 μl of Smart Taq Pre-Mix (Solgent, Daejeon, Korea) containing 1 μl of cDNA as a template and 10 pico-moles of each primer. PCR reaction was performed as the following conditions: initial denaturation for 2 min at 95˚C, 35 cycles of 95˚C for 20 sec, 55˚C for 40 sec and 72˚C for 30 sec, and additional extension for 5 min at 72˚C. PCR products were separated and visualized on 2% of agarose gel. Primers used to detect CSVd were as follows: forward, 5' CTACTACCCGGTGGAAACAACTG 3'; reverse, 5' GGACTTCCTCCAGGTTTCCC 3'.
Results and Discussion
Effect of meristem size on CSVd elimination
As shown in Table 1, the sizes of meristems affected both the meristem survival and CSVd elimination ratio on shoot tip culture of CSVdinfected chrysanthemums. The meristems of 0.5mm or larger were more viable than smaller ones (0.2 ~ 0.4mm with 1 or 2 leaf primordia) while no regenerated CSVd-free plants were produced. However, meristems (0.2-0.4mm) with 1 or 2 leaf primordia were produced CSVd-free plantlet in 28.6 and 22.2%, respectively, although they showed lower survival ratio than larger ones (Table 1). In general, the size of excised shoot tip is negatively correlated with the percentage of viroid-free plantlets obtained, and is positively correlated with the percentage of plantlet regeneration (Zhu et al., 2001). It has been also observed that plantlets derived from leaf primordiafree shoot meristem were relatively CSVd negative (Hosokawa et al., 2004).
Table 1. Effect of meristem tip size on CSVd elimination from shoot tip culture of CSVd-infected chrysanthemum ‘Ency’.
Effect of in vitro thermotherapy combined with shoot tip culture.
To measure the efficiency of in vitro thermotherapy combined with shoot tip culture, the ratio of total viroid-free plants obtained and total meristems cultured was calculated. Heat treatment at 37˚C for 2 up to 8 weeks followed by meristem tip culture was not effective to eliminate CSVd from chrysanthemum ‘Ency’ (Table 2). Heat treated in vitro plants (6 weeks at 37˚C) produced bigger shoots than those untreated (data not shown). However, this condition did not affect to the increase of survival rate after shoot tip culture. In addition, the prolonged heat treatment led to damage on leaves or shoots of in vitro explants so as the survivals percentage declined from 37.8 to 18.5% according to increase of heat treatment period. Shoots of the regenerated plantlets from the infected plants were tested by RT-PCR.Results showed that the 214-bp band corresponding to CSVd was detected from infected plantlets and absent in regenerated CSVd-free plantlets (Fig. 1).
Table 2. Effect of heat treatment combined with shoot tip culture on CSVd elimination from CSVd-infected chrysanthemum ‘Ency’.
Fig. 1. RT-PCR detection of the chrysanthemum stunt viroid (CSVd) from in some plantlets regenerated from the heat-treated meristems of CSVd-infected chrysanthemum ‘Ency’. Amplified fragments were separated by electrophoresis on a 2.0% agarose gel and visualized by ethidium bromide staining. Lanes M, 100-bp ladder marker; lane p, positive control; lane 1-10 regenerated plantlet by shoots tip culture. Control, no heat treatment. 2 weeks and 4 weeks, heat treatment at 37˚C for 2 or 4 weeks, respectively.
Subcultures from tips of the viroid-free plantlets were tested again by RT-PCR before transplanting into the pots, and the same results were obtained (data not shown).
Since the temperature stress on the in vitro shoots for meristem tip culture did not have significant effect on the viroid elimination rate, the efficiency of in vitro therapy for CSVd elimination depended on the survival rate, which was greatly influenced by the meristem size. Despite of our attempt on increasing the survivals by using uniform meristem tip cuttings with 2 leaf primordia, the survivals obtained were still low and even decreased as the increase of heat treatment period. It is known that viroid synthesis occurred at high temperature (35˚C) even after 48hour inoculation (Mülbach and Sänger, 1977). However, there are some positive results on CSVd elimination by heat treatment. Two of 72 chrysanthemum ‘Mistletoe’ were found to be CSVd-free after 32 and 35 weeks of heat treatment at 35˚C (Hollings and Stone, 1970). Chung et al. (2006) have also been shown that high temperature (35˚C) force to reduce CSVd concentration from chrysanthemum ‘Sharotte’ and the effect is dependent on cultivar.
Growth characteristics of CSVd-free chrysanthemum plants
CSVd negative plants were measured and their numbers of flowers and nodes were counted. Stem length, numbers of nodes and flowers of 28 CSVd negative plants were 478 mm, 17 and 6, respectively, whereas in 7 of CSVd positive plants were 413mm, 14 and 3, respectively (Table 3). The CSVd-free plants grew more vigorously than CSVd-infected plants (Fig. 2).
Table 3. Comparison of plant characteristics between CSVd-infected and CSVd-free plants from the shoot tip culture of from CSVd-infected chrysanthemum ‘Ency’.
Fig. 2. Growth characteristics of the CSVd-free plant (C1 and C2) and CSVd-infected plant detected by RT-PCR (V1 and V2). The CSVd-free plant grew vigorously and its internode is longer than that of the infected plant. The photograph was taken about 80 days after cultivation in a greenhouse with night interruption lighting
Among several diseases caused by CSVd infection, stem stunting is the most common disease affected the infected plants (Horst et al., 1977). In this experiment, we observed that stem length of CSVdinfected chrysanthemum ‘Ency’ reduced up to 13.8%, and the nodes number diminished by 17.8% as well (Table 3). The different height of both infected and normal plants was clearly showed on Figure 3. Hosokawa et al. (2004) observed that plant height of chrysan-themum ‘Piato’ was reduced in 46.4% by CSVd infection. Chung et al. (2005) reported that stem lengths of CSVd-infected chrysanthemum ‘Sharotte’, ‘Delmont’ and ‘Kasandra’ were reduced in 50%, 41.5% and 31.8%, respectively. The severity of stunt disease varies dependent on cultivars and cultural conditions such as temperature and light intensity (Bachelier et al., 1976; Handley and Horst, 1988).
Acknowledgement
This study was supported by a grant of the Rural Development Administration in Korea.
Reference
2.Chung, B.N., E.J. Huh, and J.S. Kim. 2006. Effect of temperature on the concentration of Chrysanthemum stunt viroid in CSVd-infected chrysanthemum. Plant Pathol. J. 22:152-154.
3.Chung, B.N., J.H. Lim, S.Y. Choi, J.S. Kim, and E.J. Lee. 2005. Occurrence of Chrysanthemum stunt viroid in chrysanthemum in Korea. Plant Pathol J. 21:377-382.
4.Diener, T.O. and R.H. Lawson. 1973. Chrysanthemum stunt: a viroid disease. Virology. 51:94-101.
5.Dimock, A.W. 1947. Chrysanthemum stunt. N Y State Flower Grow Bull 26:2.
6.Flores, R., J.W. Randles, M. Bar-Joseph, and T.O. Diener. 1998. A proposed scheme for viroid classification and nomenclature. Arch Virol. 143:623-630.
7.Handley, M.K. and R.K. Horst. 1988. The effect of temperature and light on chrysanthemum stunt viroid infection of florists chrysanthemum. Acta Horticulturae. 234:89-97.
8.Hollings, M. and O.M. Stone. 1970. Attempts to eliminate chrysanthemum stunt from chrysanthemum by meristem-tip culture after heat treatment. Ann Appl Biol. 73:333-348.
9.Horst, R.K., R.W. Langhans, and S.H. Smith. 1977. Effects of chrysanthemum stunt, chlorotic mottle, aspermy and mosaic on flowering and rooting of chrysanthemum. Phytopathology. 67:9-14.
10.Hosokawa, M., A. Otake, K. Ohishi, E. Ueda, T. Hayashi, and S. Yazawa. 2004. Elimination of Chrysanthemum stunt viroid from an infected chrysanthemum cultivar by shoot regeneration from a leaf primordium-free shoot apical meristem dome attached to a root tip. Plant Cell Rep. 22:859-863.
11.Knapp, E., A. da Camara Machado, H. Puhringer, Q. Wang, V. Hanzer, B. Weiss, H. Weiss, H. Katinger, M.L. da Camara Machado. 1995. Localization of fruit tree viruses by immuno-tissue printing in infected shoots of Malus sp. and Prunus sp. J Virol Methods 55:157-173.
12.Mühlbach, H.P. and H.L. Sänger. 1977. Multiplication of cucumber pale fruit viroid in inoculated tomato leaf protoplasts. J. Gen. Virol. 35:377-386.
13.Murashige, T. and F. Skoog. 1962. A revised medium for rapid growth and bioassay with tobacco tissue culture. Physiol. Planta.15:473-497.
14.Randles, J.W. 2003. Viroids: economic impact of viroid diseases, p. 3-11. In: A. Hadidi (eds.) Viroids. CSIRO Publishing, Collinwood, Australia.
15.Siano, A.B., C.K. Kim, M.Y. Chung, J.S. Park, K.B. Lim, and J.D. Chung. 2007. Effect of plant growth regulator and light intensity on shoot tip culture of chrysanthemum. Flower Res. J. 15:151-157.
16.Zhu Y., L. Green, Y. Woo, R. Owens, and B. Ding. 2001. Cellular basis of Potato spindle tuber viroid systemic movement. Virology. 279:69-77.
-
-
Journal Abbreviation : 'Flower Res. J.'
Frequency : Quarterly
Doi Prefix : 10.11623/frj.
ISSN : 1225-5009 (Print) / 2287-772X (Online)
Year of Launching : 1991
Publisher : The Korean Society for Floricultural Science
Indexed/Tracked/Covered By :
-
Online Submission
submission.ijfs.org
-
Template DOWNLOAD
Original Research
Articles국문 영문Review Articles 리뷰 ★NEWTechnical Reports단보 New Cultivar
Introduction 품종 -
논문유사도검사
-
KSFS
Korean Society for
Floricultural Science -
Contact Us
Flower Research Journal- Tel: +82-54-820-5472
- E-mail: kafid@hanmail.net -
-
-
-
-
-
-
-
